Orthologous regulated operons containing nadD gene
| Regulog: | NrtR - Pseudomonadaceae |
| Regulator type: | Transcription factor |
| Regulator family: | NrtR |
| Regulation mode: | repressor |
| Biological process: | NAD biosynthesis |
| Effector: | Adenosine diphosphate ribose |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Pseudomonas aeruginosa PAO1 | ||||
|
Position: -69
Score: 5.42041 Sequence: ATAATTCATCACGTGAAATAA
Locus tag: PA4917
Name: nadD Funciton: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family
Locus tag: PA4916
Name: nrtR Funciton: Nudix-related transcriptional regulator NrtR |
||||
| nadD-nrtR | -69 | 5.4 | ATAATTCATCACGTGAAATAA | PA4917 |
| Pseudomonas fluorescens Pf-5 | ||||
|
Position: -156
Score: 5.46795 Sequence: AAAGTATATGTCATGTACTTT
Position: -35
Score: 5.41151 Sequence: AAGGTACACGTCATGTACCAA
Locus tag: PFL_2465
Name: nadD Funciton: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family
Locus tag: PFL_2464
Name: nrtR Funciton: Nudix-related transcriptional regulator NrtR
Locus tag: PFL_2463
Name: null Funciton: ADP-ribose pyrophosphatase (EC 3.6.1.13) |
||||
| nadD-nrtR-PFL_2463 | -156 | 5.5 | AAAGTATATGTCATGTACTTT | PFL_2465 |
| -35 | 5.4 | AAGGTACACGTCATGTACCAA | ||