Orthologous regulated operons containing nadD gene

Properties
Regulog:	NrtR - Oceanospirillales/Alteromonadales
Regulator type:	Transcription factor
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Phylum:	Proteobacteria/gamma

Built upon 7 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Marinobacter sp. ELB17
Position: -75 Score: 4.71508 Sequence: TCTGTCAAATCAATTGACACA Locus tag: MELB17_12286 Name: pncB Funciton: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12) Locus tag: MELB17_12291 Name: nadE Funciton: NAD synthetase (EC 6.3.1.5) Locus tag: MELB17_12296 Name: pncA Funciton: Nicotinamidase (EC 3.5.1.19) Locus tag: MELB17_12301 Name: nadD Funciton: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family
pncB-nadE-pncA-nadD	-75	4.7	TCTGTCAAATCAATTGACACA	MELB17_12286

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --