Orthologous regulated operons containing ELI_12765 gene

Properties
Regulog:	IscR - Sphingomonadales
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Phylum:	Proteobacteria

Built upon 7 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Erythrobacter litoralis HTCC2594
Position: -40 Score: 7.0465 Sequence: AAATCGGAACGATTTGGTCCGATTT Locus tag: ELI_12790 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: ELI_12785 Name: sufB Funciton: Iron-sulfur cluster assembly protein SufB Locus tag: ELI_12780 Name: ELI_12780 Funciton: Hypothetical protein Locus tag: ELI_12775 Name: ycjD Funciton: Conserved hypothetical protein Locus tag: ELI_12770 Name: ELI_12770 Funciton: Hypothetical protein Locus tag: ELI_12765 Name: ELI_12765 Funciton: Conserved hypothetical protein Locus tag: ELI_12760 Name: sufC Funciton: Iron-sulfur cluster assembly ATPase protein SufC Locus tag: ELI_12755 Name: sufD Funciton: Iron-sulfur cluster assembly protein SufD Locus tag: ELI_12750 Name: sufS Funciton: Cysteine desulfurases, SufS subfamily Locus tag: ELI_12745 Name: sufT Funciton: Iron sulfur cluster assembly protein SufT Locus tag: ELI_12740 Name: sufA Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
iscR-sufB-ELI_12780-ycjD-ELI_12770-ELI_12765-sufC-sufD-sufS-sufT-sufA	-40	7	AAATCGGAACGATTTGGTCCGATTT	ELI_12790
Erythrobacter sp. NAP1
Position: -61 Score: 7.05614 Sequence: AAATCCGACTGATTCAGTCCGATTT Locus tag: NAP1_13233 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: NAP1_13238 Name: sufB Funciton: Iron-sulfur cluster assembly protein SufB Locus tag: NAP1_13243 Name: ycjD Funciton: Conserved hypothetical protein Locus tag: NAP1_13248 Name: ELI_12765 Funciton: Conserved hypothetical protein Locus tag: NAP1_13253 Name: sufC Funciton: Iron-sulfur cluster assembly ATPase protein SufC Locus tag: NAP1_13258 Name: NAP1_13258 Funciton: Hypothetical protein Locus tag: NAP1_13263 Name: sufD Funciton: Iron-sulfur cluster assembly protein SufD Locus tag: NAP1_13268 Name: sufS Funciton: Cysteine desulfurases, SufS subfamily Locus tag: NAP1_13273 Name: sufT Funciton: Iron sulfur cluster assembly protein SufT Locus tag: NAP1_13278 Name: sufA Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
iscR-sufB-ycjD-ELI_12765-sufC-NAP1_13258-sufD-sufS-sufT-sufA	-61	7.1	AAATCCGACTGATTCAGTCCGATTT	NAP1_13233