Orthologous regulated operons containing ELI_12770 gene
Regulog: | IscR - Sphingomonadales |
Regulator type: | Transcription factor |
Regulator family: | Rrf2 |
Regulation mode: | activator (repressor) |
Biological process: | Iron-sulfur cluster biogenesis |
Effector: | Iron-sulfur cluster redox state |
Phylum: | Proteobacteria |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Erythrobacter litoralis HTCC2594 | ||||
Position: -40
Score: 7.0465 Sequence: AAATCGGAACGATTTGGTCCGATTT
Locus tag: ELI_12790
Name: iscR Funciton: Iron-sulfur cluster regulator IscR
Locus tag: ELI_12785
Name: sufB Funciton: Iron-sulfur cluster assembly protein SufB
Locus tag: ELI_12780
Name: ELI_12780 Funciton: Hypothetical protein
Locus tag: ELI_12775
Name: ycjD Funciton: Conserved hypothetical protein
Locus tag: ELI_12770
Name: ELI_12770 Funciton: Hypothetical protein
Locus tag: ELI_12765
Name: ELI_12765 Funciton: Conserved hypothetical protein
Locus tag: ELI_12760
Name: sufC Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: ELI_12755
Name: sufD Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: ELI_12750
Name: sufS Funciton: Cysteine desulfurases, SufS subfamily
Locus tag: ELI_12745
Name: sufT Funciton: Iron sulfur cluster assembly protein SufT
Locus tag: ELI_12740
Name: sufA Funciton: Iron binding protein SufA for iron-sulfur cluster assembly |
||||
iscR-sufB-ELI_12780-ycjD-ELI_12770-ELI_12765-sufC-sufD-sufS-sufT-sufA | -40 | 7 | AAATCGGAACGATTTGGTCCGATTT | ELI_12790 |