Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing SJA_C1-33970 gene

Properties
Regulog: IscR - Sphingomonadales
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Proteobacteria
Built upon 7 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Sphingobium japonicum UT26S
Position: -51
Score: 6.84792
Sequence: CAATCGGATGGATTCGATCCGATTT
Locus tag: SJA_C1-34000
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: SJA_C1-33990
Name: sufB
Funciton: Iron-sulfur cluster assembly protein SufB
Locus tag: SJA_C1-33980
Name: ycjD
Funciton: Conserved hypothetical protein
Locus tag: SJA_C1-33970
Name: SJA_C1-33970
Funciton: Hypothetical protein
Locus tag: SJA_C1-33960
Name: sufC
Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: SJA_C1-33950
Name: sufD
Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: SJA_C1-33940
Name: sufS
Funciton: Cysteine desulfurases, SufS subfamily
Locus tag: SJA_C1-33930
Name: sufT
Funciton: Iron sulfur cluster assembly protein SufT
Locus tag: SJA_C1-33920
Name: sufA
Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
iscR-sufB-ycjD-SJA_C1-33970-sufC-sufD-sufS-sufT-sufA -51 6.8 CAATCGGATGGATTCGATCCGATTT SJA_C1-34000