Orthologous regulated operons containing SJA_C1-33970 gene
| Regulog: | IscR - Sphingomonadales |
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | activator (repressor) |
| Biological process: | Iron-sulfur cluster biogenesis |
| Effector: | Iron-sulfur cluster redox state |
| Phylum: | Proteobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Sphingobium japonicum UT26S | ||||
|
Position: -51
Score: 6.84792 Sequence: CAATCGGATGGATTCGATCCGATTT
Locus tag: SJA_C1-34000
Name: iscR Funciton: Iron-sulfur cluster regulator IscR
Locus tag: SJA_C1-33990
Name: sufB Funciton: Iron-sulfur cluster assembly protein SufB
Locus tag: SJA_C1-33980
Name: ycjD Funciton: Conserved hypothetical protein
Locus tag: SJA_C1-33970
Name: SJA_C1-33970 Funciton: Hypothetical protein
Locus tag: SJA_C1-33960
Name: sufC Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: SJA_C1-33950
Name: sufD Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: SJA_C1-33940
Name: sufS Funciton: Cysteine desulfurases, SufS subfamily
Locus tag: SJA_C1-33930
Name: sufT Funciton: Iron sulfur cluster assembly protein SufT
Locus tag: SJA_C1-33920
Name: sufA Funciton: Iron binding protein SufA for iron-sulfur cluster assembly |
||||
| iscR-sufB-ycjD-SJA_C1-33970-sufC-sufD-sufS-sufT-sufA | -51 | 6.8 | CAATCGGATGGATTCGATCCGATTT | SJA_C1-34000 |