Orthologous regulated operons containing nadE gene

Properties
Regulog:	NrtR - Psychromonadaceae/Aeromonadales
Regulator type:	Transcription factor
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Phylum:	Proteobacteria/gamma

Built upon 6 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Tolumonas auensis DSM 9187
Position: -109 Score: 5.36944 Sequence: TTGGTATCTTAAAGGAACCAA Locus tag: Tola_0586 Name: pncB Funciton: Nicotinate phosphoribosyltransferase (EC 2.4.2.11) Locus tag: Tola_0587 Name: nadE Funciton: NAD+ synthetase
pncB-nadE	-109	5.4	TTGGTATCTTAAAGGAACCAA	Tola_0586

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --