Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing fdx gene

Properties
Regulog: IscR - Rhodospirillales
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Proteobacteria
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Azospirillum sp. B510
Position: -200
Score: 7.04525
Sequence: ATTCTTGACCGTTTTGCTTGGTCAT
Locus tag: AZL_020070
Name: cysE
Funciton: Serine acetyltransferase (EC 2.3.1.30)
Locus tag: AZL_020080
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: AZL_020090
Name: iscS2
Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Locus tag: AZL_020100
Name: hscB
Funciton: Chaperone protein HscB
Locus tag: AZL_020110
Name: fdx
Funciton: ferredoxin, 2Fe-2S type, ISC system
cysE-iscR-iscS2-hscB-fdx -200 7 ATTCTTGACCGTTTTGCTTGGTCAT AZL_020070
Magnetospirillum magneticum AMB-1
Position: -117
Score: 7.27612
Sequence: AATCTTGACTGGCCTTGTCGGACAT
Locus tag: amb3031
Name: cysE
Funciton: Serine acetyltransferase (EC 2.3.1.30)
Locus tag: amb3030
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: amb3029
Name: iscS2
Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Locus tag: amb3028
Name: iscS
Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Locus tag: amb3027
Name: iscU
Funciton: Iron-sulfur cluster assembly scaffold protein IscU
Locus tag: amb3026
Name: iscA
Funciton: Iron binding protein IscA for iron-sulfur cluster assembly
Locus tag: amb3025
Name: hscB
Funciton: Chaperone protein HscB
Locus tag: amb3024
Name: hscA
Funciton: Chaperone protein HscA
Locus tag: amb3023
Name: fdx
Funciton: ferredoxin, 2Fe-2S type, ISC system
Locus tag: amb3022
Name: yfhJ
Funciton: putative Fe-S cluster assembly protein
cysE-iscR-iscS2-iscS-iscU-iscA-hscB-hscA-fdx-yfhJ -117 7.3 AATCTTGACTGGCCTTGTCGGACAT amb3031
Rhodospirillum rubrum ATCC 11170
Position: -116
Score: 6.96087
Sequence: ATTCTTGACCGATTTTCTCGGACAC
Locus tag: Rru_A2029
Name: cysE
Funciton: Serine acetyltransferase (EC 2.3.1.30)
Locus tag: Rru_A2028
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: Rru_A2027
Name: iscS2
Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Locus tag: Rru_A2026
Name: fdx
Funciton: ferredoxin, 2Fe-2S type, ISC system
cysE-iscR-iscS2-fdx -116 7 ATTCTTGACCGATTTTCTCGGACAC Rru_A2029