Orthologous regulated operons containing ybfE gene
| Regulog: | LexA - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Escherichia coli str. K-12 substr. MG1655 | ||||
|
Position: -136
Score: 4.46557 Sequence: AACTGATTAAAAACCCAGCG
Locus tag: b0685
Name: ybfE Funciton: LexA regulated protein |
||||
| ybfE | -136 | 4.5 | AACTGATTAAAAACCCAGCG | b0685 |