Orthologous regulated operons containing cyoD gene
Regulog: | PdhR - Enterobacteriales |
Regulator type: | Transcription factor |
Regulator family: | GntR/Others |
Regulation mode: | repressor |
Biological process: | Pyruvate metabolism |
Effector: | Pyruvate |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Citrobacter koseri ATCC BAA-895 | ||||
Position: -230
Score: 5.69906 Sequence: TACATTGGTTATACCAATTAC
Locus tag: CKO_02729
Name: null Funciton: cytochrome o ubiquinol oxidase subunit II
Locus tag: CKO_02730
Name: null Funciton: cytochrome o ubiquinol oxidase subunit I
Locus tag: CKO_02731
Name: null Funciton: cytochrome o ubiquinol oxidase subunit III
Locus tag: CKO_02732
Name: null Funciton: cytochrome o ubiquinol oxidase subunit IV
Locus tag: CKO_02733
Name: null Funciton: protoheme IX farnesyltransferase |
||||
CKO_02729-CKO_02730-CKO_02731-CKO_02732-CKO_02733 | -230 | 5.7 | TACATTGGTTATACCAATTAC | CKO_02729 |
Enterobacter sp. 638 | ||||
Position: -243
Score: 5.13105 Sequence: AGCAATGGTTATACCAATTGC
Locus tag: Ent638_0899
Name: null Funciton: cytochrome o ubiquinol oxidase subunit II
Locus tag: Ent638_0898
Name: null Funciton: cytochrome o ubiquinol oxidase subunit I
Locus tag: Ent638_0897
Name: null Funciton: cytochrome o ubiquinol oxidase subunit III
Locus tag: Ent638_0896
Name: null Funciton: cytochrome o ubiquinol oxidase subunit IV
Locus tag: Ent638_0895
Name: null Funciton: protoheme IX farnesyltransferase |
||||
Ent638_0899-Ent638_0898-Ent638_0897-Ent638_0896-Ent638_0895 | -243 | 5.1 | AGCAATGGTTATACCAATTGC | Ent638_0899 |
Escherichia coli str. K-12 substr. MG1655 | ||||
Position: -230
Score: 5.66584 Sequence: CACATTGGTTATACCAATTGC
Locus tag: b0432
Name: cyoA Funciton: cytochrome o ubiquinol oxidase subunit II
Locus tag: b0431
Name: cyoB Funciton: cytochrome o ubiquinol oxidase subunit I
Locus tag: b0430
Name: cyoC Funciton: cytochrome o ubiquinol oxidase subunit III
Locus tag: b0429
Name: cyoD Funciton: cytochrome o ubiquinol oxidase subunit IV
Locus tag: b0428
Name: cyoE Funciton: protoheme IX farnesyltransferase |
||||
cyoA-cyoB-cyoC-cyoD-cyoE | -230 | 5.7 | CACATTGGTTATACCAATTGC | b0432 |
Salmonella typhimurium LT2 | ||||
Position: -230
Score: 5.62576 Sequence: TACATTGGTTATACCAATTAT
Locus tag: STM0443
Name: cyoA Funciton: cytochrome o ubiquinol oxidase subunit II
Locus tag: STM0442
Name: cyoB Funciton: cytochrome o ubiquinol oxidase subunit I
Locus tag: STM0441
Name: cyoC Funciton: cytochrome o ubiquinol oxidase subunit III
Locus tag: STM0440
Name: cyoD Funciton: cytochrome o ubiquinol oxidase subunit IV
Locus tag: STM0439
Name: cyoE Funciton: protoheme IX farnesyltransferase |
||||
cyoA-cyoB-cyoC-cyoD-cyoE | -230 | 5.6 | TACATTGGTTATACCAATTAT | STM0443 |