Orthologous regulated operons containing KPN_pKPN5p08225 gene
| Regulog: | LexA - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||||
|
Position: -44
Score: 5.60955 Sequence: TACTGTATGCATAACCAGTA
Locus tag: KPN_pKPN5p08226
Name: impA Funciton: ImpA-like protein; UV protection
Locus tag: KPN_pKPN5p08225
Name: null Funciton: mutagenesis by UV and mutagens |
||||
| impA-KPN_pKPN5p08225 | -44 | 5.6 | TACTGTATGCATAACCAGTA | KPN_pKPN5p08226 |