Orthologous regulated operons containing dinQ gene
| Regulog: | LexA - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Escherichia coli str. K-12 substr. MG1655 | ||||
|
Position: -188
Score: 4.31841 Sequence: TGCTGGTTTTATAACCTGCA
Position: -166
Score: 5.72977 Sequence: TACTGTATGATTATCCAGTT
Locus tag: b4613
Name: dinQ Funciton: Damage inducible, function unknown |
||||
| dinQ | -188 | 4.3 | TGCTGGTTTTATAACCTGCA | b4613 |
| -166 | 5.7 | TACTGTATGATTATCCAGTT | ||