Orthologous regulated operons containing mug gene
| Regulog: | LexA - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Citrobacter koseri ATCC BAA-895 | ||||
|
Position: -70
Score: 4.68162 Sequence: TGCTGTTTTTATAAACAACG
Locus tag: CKO_04467
Name: null Funciton: DNA glycosylase, G/U mismatch specific |
||||
| CKO_04467 | -70 | 4.7 | TGCTGTTTTTATAAACAACG | CKO_04467 |
| Enterobacter sp. 638 | ||||
|
Position: -70
Score: 4.91529 Sequence: TGCTGTTTTTATAAACAATG
Locus tag: Ent638_3474
Name: null Funciton: DNA glycosylase, G/U mismatch specific |
||||
| Ent638_3474 | -70 | 4.9 | TGCTGTTTTTATAAACAATG | Ent638_3474 |
| Escherichia coli str. K-12 substr. MG1655 | ||||
|
Position: -69
Score: 4.91529 Sequence: TGCTGTTTTTATAAACAATG
Locus tag: b3068
Name: ygjF Funciton: DNA glycosylase, G/U mismatch specific |
||||
| ygjF | -69 | 4.9 | TGCTGTTTTTATAAACAATG | b3068 |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||||
|
Position: -69
Score: 4.91529 Sequence: TGCTGTTTTTATAAACAATG
Locus tag: KPN_03475
Name: ygjF Funciton: DNA glycosylase, G/U mismatch specific |
||||
| ygjF | -69 | 4.9 | TGCTGTTTTTATAAACAATG | KPN_03475 |
| Salmonella typhimurium LT2 | ||||
|
Position: -70
Score: 4.91529 Sequence: TGCTGTTTTTATAAACAATG
Locus tag: STM3212
Name: mug Funciton: DNA glycosylase, G/U mismatch specific |
||||
| mug | -70 | 4.9 | TGCTGTTTTTATAAACAATG | STM3212 |