Orthologous regulated operons containing yntB gene
| Regulog: | NikR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | NikR |
| Regulation mode: | repressor |
| Biological process: | Nickel homeostasis |
| Effector: | Nickel ion, (Ni2+) |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Edwardsiella tarda EIB202 | ||||
|
Position: -171
Score: 5.27379 Sequence: GTATGCAGAAGTAAGGAAAAGTGCATAC
Locus tag: ETAE_1580
Name: yntA Funciton: predicted nickel ABC transporter, substrate-binding protein
Locus tag: ETAE_1579
Name: yntB Funciton: predicted nickel ABC transporter, permease protein
Locus tag: ETAE_1578
Name: yntC Funciton: predicted nickel ABC transporter, permease protein
Locus tag: ETAE_1577
Name: yntD Funciton: predicted nickel ABC transporter, ATP-binding protein
Locus tag: ETAE_1576
Name: yntE Funciton: predicted nickel ABC transporter, ATPase component |
||||
| yntA-yntB-yntC-yntD-yntE | -171 | 5.3 | GTATGCAGAAGTAAGGAAAAGTGCATAC | ETAE_1580 |
| Salmonella typhimurium LT2 | ||||
|
Position: -101
Score: 6.50784 Sequence: GTATGATGTTTTTAAAAGATCGTCATAC
Locus tag: STM1255
Name: yntA Funciton: predicted nickel ABC transporter, substrate-binding protein
Locus tag: STM1256
Name: yntB Funciton: predicted nickel ABC transporter, permease protein
Locus tag: STM1257
Name: yntC Funciton: predicted nickel ABC transporter, permease protein
Locus tag: STM1258
Name: yntD Funciton: predicted nickel ABC transporter, ATP-binding protein
Locus tag: STM1259
Name: yntE Funciton: predicted nickel ABC transporter, ATPase component |
||||
| yntA-yntB-yntC-yntD-yntE | -101 | 6.5 | GTATGATGTTTTTAAAAGATCGTCATAC | STM1255 |