Orthologous regulated operons containing fdx gene
| Regulog: | IscR - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | activator (repressor) |
| Biological process: | Iron-sulfur cluster biogenesis |
| Effector: | Iron-sulfur cluster redox state |
| Phylum: | Proteobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Oceanospirillum sp. MED92 | ||||
|
Position: -68
Score: 5.36451 Sequence: TTAATTGACCTTTTTGGTCGGGTAT
Locus tag: MED92_00535
Name: iscR Funciton: Iron-sulfur cluster regulator IscR
Locus tag: MED92_00540
Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Locus tag: MED92_00545
Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU
Locus tag: MED92_00550
Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly
Locus tag: MED92_00555
Name: hscB Funciton: Chaperone protein HscB
Locus tag: MED92_00560
Name: hscA Funciton: Chaperone protein HscA
Locus tag: MED92_00565
Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system |
||||
| iscR-iscS-iscU-iscA-hscB-hscA-fdx | -68 | 5.4 | TTAATTGACCTTTTTGGTCGGGTAT | MED92_00535 |