Orthologous regulated operons containing betA gene

Properties
Regulog:	BetI - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Glycine betaine synthesis
Effector:	Choline
Phylum:	Proteobacteria/gamma

Built upon 14 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -48 Score: 6.63306 Sequence: TATATTGAACGTCCAATCAA Locus tag: CKO_02582 Name: betI Funciton: transcriptional regulator of glycine betaine synthesis Locus tag: CKO_02583 Name: betB Funciton: betaine aldehyde dehydrogenase, NAD-dependent Locus tag: CKO_02584 Name: betA Funciton: choline dehydrogenase
betI-betB-betA	-48	6.6	TATATTGAACGTCCAATCAA	CKO_02582
Erwinia amylovora ATCC 49946
Position: -66 Score: 6.90108 Sequence: TTGATTGAACGTTCAATATA Locus tag: EAM_1685 Name: betI Funciton: transcriptional regulator of glycine betaine synthesis Locus tag: EAM_1686 Name: betB Funciton: betaine aldehyde dehydrogenase, NAD-dependent Locus tag: EAM_1687 Name: betA Funciton: choline dehydrogenase
betI-betB-betA	-66	6.9	TTGATTGAACGTTCAATATA	EAM_1685
Erwinia carotovora subsp. atroseptica SCRI1043
Position: -103 Score: 7.01471 Sequence: TTTATTGAACGTTCAATCAA Locus tag: ECA1744 Name: betI Funciton: transcriptional regulator of glycine betaine synthesis Locus tag: ECA1745 Name: betB Funciton: betaine aldehyde dehydrogenase, NAD-dependent Locus tag: ECA1746 Name: betA Funciton: choline dehydrogenase
betI-betB-betA	-103	7	TTTATTGAACGTTCAATCAA	ECA1744
Escherichia coli str. K-12 substr. MG1655
Position: -66 Score: 6.63306 Sequence: TATATTGAACGTCCAATCAA Locus tag: b0313 Name: betI Funciton: transcriptional regulator of glycine betaine synthesis Locus tag: b0312 Name: betB Funciton: betaine aldehyde dehydrogenase, NAD-dependent Locus tag: b0311 Name: betA Funciton: choline dehydrogenase
betI-betB-betA	-66	6.6	TATATTGAACGTCCAATCAA	b0313
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -48 Score: 6.63306 Sequence: TATATTGAACGTCCAATCAA Locus tag: KPN_00586 Name: betI Funciton: transcriptional regulator of glycine betaine synthesis Locus tag: KPN_00585 Name: betB Funciton: betaine aldehyde dehydrogenase, NAD-dependent Locus tag: KPN_00584 Name: betA Funciton: choline dehydrogenase
betI-betB-betA	-48	6.6	TATATTGAACGTCCAATCAA	KPN_00586
Proteus mirabilis HI4320
Position: -68 Score: 6.53265 Sequence: TTGATTGAATGTTCAATTAA Locus tag: PMI1461 Name: betI Funciton: transcriptional regulator of glycine betaine synthesis Locus tag: PMI1460 Name: betB Funciton: betaine aldehyde dehydrogenase, NAD-dependent Locus tag: PMI1459 Name: betA Funciton: choline dehydrogenase
betI-betB-betA	-68	6.5	TTGATTGAATGTTCAATTAA	PMI1461
Serratia proteamaculans 568
Position: -124 Score: 7.01471 Sequence: TTTATTGAACGTTCAATCAA Locus tag: Spro_1513 Name: betI Funciton: transcriptional regulator of glycine betaine synthesis Locus tag: Spro_1514 Name: betB Funciton: betaine aldehyde dehydrogenase, NAD-dependent Locus tag: Spro_1515 Name: betA Funciton: choline dehydrogenase
betI-betB-betA	-124	7	TTTATTGAACGTTCAATCAA	Spro_1513

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing betA gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --