Orthologous regulated operons containing betB gene
| Regulog: | BetI - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Glycine betaine synthesis |
| Effector: | Choline |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Citrobacter koseri ATCC BAA-895 | ||||
|
Position: -48
Score: 6.63306 Sequence: TATATTGAACGTCCAATCAA
Locus tag: CKO_02582
Name: betI Funciton: transcriptional regulator of glycine betaine synthesis
Locus tag: CKO_02583
Name: betB Funciton: betaine aldehyde dehydrogenase, NAD-dependent
Locus tag: CKO_02584
Name: betA Funciton: choline dehydrogenase |
||||
| betI-betB-betA | -48 | 6.6 | TATATTGAACGTCCAATCAA | CKO_02582 |
| Erwinia amylovora ATCC 49946 | ||||
|
Position: -66
Score: 6.90108 Sequence: TTGATTGAACGTTCAATATA
Locus tag: EAM_1685
Name: betI Funciton: transcriptional regulator of glycine betaine synthesis
Locus tag: EAM_1686
Name: betB Funciton: betaine aldehyde dehydrogenase, NAD-dependent
Locus tag: EAM_1687
Name: betA Funciton: choline dehydrogenase |
||||
| betI-betB-betA | -66 | 6.9 | TTGATTGAACGTTCAATATA | EAM_1685 |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ||||
|
Position: -103
Score: 7.01471 Sequence: TTTATTGAACGTTCAATCAA
Locus tag: ECA1744
Name: betI Funciton: transcriptional regulator of glycine betaine synthesis
Locus tag: ECA1745
Name: betB Funciton: betaine aldehyde dehydrogenase, NAD-dependent
Locus tag: ECA1746
Name: betA Funciton: choline dehydrogenase |
||||
| betI-betB-betA | -103 | 7 | TTTATTGAACGTTCAATCAA | ECA1744 |
| Escherichia coli str. K-12 substr. MG1655 | ||||
|
Position: -66
Score: 6.63306 Sequence: TATATTGAACGTCCAATCAA
Locus tag: b0313
Name: betI Funciton: transcriptional regulator of glycine betaine synthesis
Locus tag: b0312
Name: betB Funciton: betaine aldehyde dehydrogenase, NAD-dependent
Locus tag: b0311
Name: betA Funciton: choline dehydrogenase |
||||
| betI-betB-betA | -66 | 6.6 | TATATTGAACGTCCAATCAA | b0313 |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||||
|
Position: -48
Score: 6.63306 Sequence: TATATTGAACGTCCAATCAA
Locus tag: KPN_00586
Name: betI Funciton: transcriptional regulator of glycine betaine synthesis
Locus tag: KPN_00585
Name: betB Funciton: betaine aldehyde dehydrogenase, NAD-dependent
Locus tag: KPN_00584
Name: betA Funciton: choline dehydrogenase |
||||
| betI-betB-betA | -48 | 6.6 | TATATTGAACGTCCAATCAA | KPN_00586 |
| Proteus mirabilis HI4320 | ||||
|
Position: -68
Score: 6.53265 Sequence: TTGATTGAATGTTCAATTAA
Locus tag: PMI1461
Name: betI Funciton: transcriptional regulator of glycine betaine synthesis
Locus tag: PMI1460
Name: betB Funciton: betaine aldehyde dehydrogenase, NAD-dependent
Locus tag: PMI1459
Name: betA Funciton: choline dehydrogenase |
||||
| betI-betB-betA | -68 | 6.5 | TTGATTGAATGTTCAATTAA | PMI1461 |
| Serratia proteamaculans 568 | ||||
|
Position: -124
Score: 7.01471 Sequence: TTTATTGAACGTTCAATCAA
Locus tag: Spro_1513
Name: betI Funciton: transcriptional regulator of glycine betaine synthesis
Locus tag: Spro_1514
Name: betB Funciton: betaine aldehyde dehydrogenase, NAD-dependent
Locus tag: Spro_1515
Name: betA Funciton: choline dehydrogenase |
||||
| betI-betB-betA | -124 | 7 | TTTATTGAACGTTCAATCAA | Spro_1513 |