Orthologous regulated operons containing nadQ gene
| Regulog: | NadQ - Moraxellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | NadQ |
| Regulation mode: | repressor |
| Biological process: | NAD biosynthesis |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Psychrobacter arcticum 273-4 | ||||
|
Position: -186
Score: 6.75739 Sequence: TTATGCTCATTTTGAGCATAA
Locus tag: Psyc_0633
Name: nadQ Funciton: Transcriptional regulator of NAD metabolism, COG4111 family |
||||
| nadQ | -186 | 6.8 | TTATGCTCATTTTGAGCATAA | Psyc_0633 |
| Psychrobacter sp. PRwf-1 | ||||
|
Position: -337
Score: 6.69484 Sequence: TTATGCTCATTTTGAGTATAA
Locus tag: PsycPRwf_1963
Name: nadQ Funciton: Transcriptional regulator of NAD metabolism, COG4111 family |
||||
| nadQ | -337 | 6.7 | TTATGCTCATTTTGAGTATAA | PsycPRwf_1963 |