Orthologous regulated operons containing nikA gene

Properties
Regulog:	NikR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	NikR
Regulation mode:	repressor
Biological process:	Nickel homeostasis
Effector:	Nickel ion, (Ni2+)
Phylum:	Proteobacteria/gamma

Built upon 9 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -207 Score: 8.04442 Sequence: GTATGATGAATCTTTAGAATCGTCATAC Locus tag: CKO_04926 Name: nikA Funciton: nickel ABC transporter, periplasmic nickel-binding protein Locus tag: CKO_04927 Name: nikB Funciton: nickel transporter permease NikB Locus tag: CKO_04928 Name: nikC Funciton: nickel transporter permease NikC Locus tag: CKO_04929 Name: nikD Funciton: nickel transporter ATP-binding protein NikD Locus tag: CKO_04930 Name: nikE Funciton: nickel transporter ATP-binding protein NikE Locus tag: CKO_04931 Name: nikR Funciton: nickel responsive regulator
nikA-nikB-nikC-nikD-nikE-nikR	-207	8	GTATGATGAATCTTTAGAATCGTCATAC	CKO_04926
Edwardsiella tarda EIB202
Position: -59 Score: 7.67008 Sequence: GTATGCAGAATTTATAAAATCATCATAC Locus tag: ETAE_1379 Name: nikA Funciton: nickel ABC transporter, periplasmic nickel-binding protein Locus tag: ETAE_1378 Name: nikB Funciton: nickel transporter permease NikB Locus tag: ETAE_1377 Name: nikC Funciton: nickel transporter permease NikC Locus tag: ETAE_1376 Name: nikD Funciton: nickel transporter ATP-binding protein NikD Locus tag: ETAE_1375 Name: nikE Funciton: nickel transporter ATP-binding protein NikE
nikA-nikB-nikC-nikD-nikE	-59	7.7	GTATGCAGAATTTATAAAATCATCATAC	ETAE_1379
Enterobacter sp. 638
Position: -64 Score: 7.87692 Sequence: GTATGATGAATTATTAGAATCGTCACAC Locus tag: Ent638_1834 Name: nikA Funciton: nickel ABC transporter, periplasmic nickel-binding protein Locus tag: Ent638_1835 Name: nikB Funciton: nickel transporter permease NikB Locus tag: Ent638_1836 Name: nikC Funciton: nickel transporter permease NikC Locus tag: Ent638_1837 Name: nikD Funciton: nickel transporter ATP-binding protein NikD Locus tag: Ent638_1838 Name: nikE Funciton: nickel transporter ATP-binding protein NikE Locus tag: Ent638_1839 Name: nikR Funciton: nickel responsive regulator
nikA-nikB-nikC-nikD-nikE-nikR	-64	7.9	GTATGATGAATTATTAGAATCGTCACAC	Ent638_1834
Escherichia coli str. K-12 substr. MG1655
Position: -65 Score: 7.99675 Sequence: GTATGACGAATACTTAAAATCGTCATAC Locus tag: b3476 Name: nikA Funciton: nickel ABC transporter, periplasmic nickel-binding protein Locus tag: b3477 Name: nikB Funciton: nickel transporter permease NikB Locus tag: b3478 Name: nikC Funciton: nickel transporter permease NikC Locus tag: b3479 Name: nikD Funciton: nickel transporter ATP-binding protein NikD Locus tag: b3480 Name: nikE Funciton: nickel transporter ATP-binding protein NikE Locus tag: b3481 Name: nikR Funciton: nickel responsive regulator
nikA-nikB-nikC-nikD-nikE-nikR	-65	8	GTATGACGAATACTTAAAATCGTCATAC	b3476
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -52 Score: 7.99675 Sequence: GTATGATGAATCACTAAAATCGTCATAC Locus tag: KPN_03850 Name: nikA Funciton: nickel ABC transporter, periplasmic nickel-binding protein Locus tag: KPN_03851 Name: nikB Funciton: nickel transporter permease NikB Locus tag: KPN_03852 Name: nikC Funciton: nickel transporter permease NikC Locus tag: KPN_03853 Name: nikD Funciton: nickel transporter ATP-binding protein NikD Locus tag: KPN_03854 Name: nikE Funciton: nickel transporter ATP-binding protein NikE Locus tag: KPN_03855 Name: nikR Funciton: nickel responsive regulator
nikA-nikB-nikC-nikD-nikE-nikR	-52	8	GTATGATGAATCACTAAAATCGTCATAC	KPN_03850