Orthologous regulated operons containing nikR gene
Regulog: | NikR - Enterobacteriales |
Regulator type: | Transcription factor |
Regulator family: | NikR |
Regulation mode: | repressor |
Biological process: | Nickel homeostasis |
Effector: | Nickel ion, (Ni2+) |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Citrobacter koseri ATCC BAA-895 | ||||
Position: -207
Score: 8.04442 Sequence: GTATGATGAATCTTTAGAATCGTCATAC
Locus tag: CKO_04926
Name: nikA Funciton: nickel ABC transporter, periplasmic nickel-binding protein
Locus tag: CKO_04927
Name: nikB Funciton: nickel transporter permease NikB
Locus tag: CKO_04928
Name: nikC Funciton: nickel transporter permease NikC
Locus tag: CKO_04929
Name: nikD Funciton: nickel transporter ATP-binding protein NikD
Locus tag: CKO_04930
Name: nikE Funciton: nickel transporter ATP-binding protein NikE
Locus tag: CKO_04931
Name: nikR Funciton: nickel responsive regulator |
||||
nikA-nikB-nikC-nikD-nikE-nikR | -207 | 8 | GTATGATGAATCTTTAGAATCGTCATAC | CKO_04926 |
Enterobacter sp. 638 | ||||
Position: -64
Score: 7.87692 Sequence: GTATGATGAATTATTAGAATCGTCACAC
Locus tag: Ent638_1834
Name: nikA Funciton: nickel ABC transporter, periplasmic nickel-binding protein
Locus tag: Ent638_1835
Name: nikB Funciton: nickel transporter permease NikB
Locus tag: Ent638_1836
Name: nikC Funciton: nickel transporter permease NikC
Locus tag: Ent638_1837
Name: nikD Funciton: nickel transporter ATP-binding protein NikD
Locus tag: Ent638_1838
Name: nikE Funciton: nickel transporter ATP-binding protein NikE
Locus tag: Ent638_1839
Name: nikR Funciton: nickel responsive regulator |
||||
nikA-nikB-nikC-nikD-nikE-nikR | -64 | 7.9 | GTATGATGAATTATTAGAATCGTCACAC | Ent638_1834 |
Escherichia coli str. K-12 substr. MG1655 | ||||
Position: -65
Score: 7.99675 Sequence: GTATGACGAATACTTAAAATCGTCATAC
Locus tag: b3476
Name: nikA Funciton: nickel ABC transporter, periplasmic nickel-binding protein
Locus tag: b3477
Name: nikB Funciton: nickel transporter permease NikB
Locus tag: b3478
Name: nikC Funciton: nickel transporter permease NikC
Locus tag: b3479
Name: nikD Funciton: nickel transporter ATP-binding protein NikD
Locus tag: b3480
Name: nikE Funciton: nickel transporter ATP-binding protein NikE
Locus tag: b3481
Name: nikR Funciton: nickel responsive regulator |
||||
nikA-nikB-nikC-nikD-nikE-nikR | -65 | 8 | GTATGACGAATACTTAAAATCGTCATAC | b3476 |
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||||
Position: -52
Score: 7.99675 Sequence: GTATGATGAATCACTAAAATCGTCATAC
Locus tag: KPN_03850
Name: nikA Funciton: nickel ABC transporter, periplasmic nickel-binding protein
Locus tag: KPN_03851
Name: nikB Funciton: nickel transporter permease NikB
Locus tag: KPN_03852
Name: nikC Funciton: nickel transporter permease NikC
Locus tag: KPN_03853
Name: nikD Funciton: nickel transporter ATP-binding protein NikD
Locus tag: KPN_03854
Name: nikE Funciton: nickel transporter ATP-binding protein NikE
Locus tag: KPN_03855
Name: nikR Funciton: nickel responsive regulator |
||||
nikA-nikB-nikC-nikD-nikE-nikR | -52 | 8 | GTATGATGAATCACTAAAATCGTCATAC | KPN_03850 |