Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing metE2 gene

Properties
Regulog: SahR - Caulobacterales
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Methionine metabolism
Effector: S-adenosylhomocysteine
Phylum: Proteobacteria/alpha
Built upon 14 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Caulobacter segnis ATCC 21756
Position: -362
Score: 6.3927
Sequence: ACATAAAGATATCCTTATGT
Locus tag: Cseg_1811
Name: DUF1852
Funciton: Protein of unknown function DUF1852
Locus tag: Cseg_1810
Name: metE2
Funciton: methionine synthase
DUF1852-metE2 -362 6.4 ACATAAAGATATCCTTATGT Cseg_1811
© 2009-2020 RegPrecise