Orthologous regulated operons containing metE gene
| Regulog: | SahR - Caulobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Methionine metabolism |
| Effector: | S-adenosylhomocysteine |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Caulobacter crescentus CB15 | ||||
|
Position: -393
Score: 6.67031 Sequence: ACATAAAGAAATCTTTATAT
Locus tag: CC0482
Name: metE Funciton: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) |
||||
| metE | -393 | 6.7 | ACATAAAGAAATCTTTATAT | CC0482 |