Orthologous regulated operons containing metH2 gene

Properties
Regulog:	SahR - Caulobacterales
Regulator type:	Transcription factor
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Methionine metabolism
Effector:	S-adenosylhomocysteine
Phylum:	Proteobacteria/alpha

Built upon 14 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Caulobacter crescentus CB15
Position: -24 Score: 6.93642 Sequence: ACATAAAGATATCTTTATGT Locus tag: CC2141 Name: sahR Funciton: Transcriptional regulator of methionine metabolism, ArsR family Locus tag: CC2140 Name: metF Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) Locus tag: CC2139 Name: null Funciton: metallo-beta-lactamase superfamily protein Locus tag: CC2138 Name: metH2 Funciton: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13) Locus tag: CC2137 Name: metH Funciton: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
sahR-metF-CC2139-metH2-metH	-24	6.9	ACATAAAGATATCTTTATGT	CC2141
Caulobacter segnis ATCC 21756
Position: -1000 Score: 6.93642 Sequence: ACATAAAGATATCTTTATGT Locus tag: Cseg_1280 Name: metF Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) Locus tag: Cseg_1281 Name: null Funciton: metallo-beta-lactamase superfamily protein Locus tag: Cseg_1282 Name: metH2 Funciton: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13) Locus tag: Cseg_1283 Name: metH Funciton: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
metF-Cseg_1281-metH2-metH	-1000	6.9	ACATAAAGATATCTTTATGT	Cseg_1280
Caulobacter sp. K31
Position: -24 Score: 6.93642 Sequence: ACATAAAGATATCTTTATGT Locus tag: Caul_3410 Name: sahR Funciton: Transcriptional regulator of methionine metabolism, ArsR family Locus tag: Caul_3409 Name: metF Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) Locus tag: Caul_3408 Name: null Funciton: metallo-beta-lactamase superfamily protein Locus tag: Caul_3407 Name: metH2 Funciton: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13) Locus tag: Caul_3406 Name: Caul_3406 Funciton: PIN domain protein Locus tag: Caul_3405 Name: Caul_3405 Funciton: PIN domain protein Locus tag: Caul_3404 Name: ddl Funciton: D-alanine--D-alanine ligase B (EC 6.3.2.4) Locus tag: Caul_3403 Name: null Funciton: hypothetical protein Locus tag: Caul_3402 Name: metH Funciton: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
sahR-metF-Caul_3408-metH2-Caul_3406-Caul_3405-ddl-Caul_3403-metH	-24	6.9	ACATAAAGATATCTTTATGT	Caul_3410
Phenylobacterium zucineum HLK1
Position: -26 Score: 6.93642 Sequence: ACATAAAGATATCTTTATGT Locus tag: PHZ_c2652 Name: sahR Funciton: Transcriptional regulator of methionine metabolism, ArsR family Locus tag: PHZ_c2651 Name: metF Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) Locus tag: PHZ_c2650 Name: metH2 Funciton: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13) Locus tag: PHZ_c2649 Name: metH Funciton: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
sahR-metF-metH2-metH	-26	6.9	ACATAAAGATATCTTTATGT	PHZ_c2652