Orthologous regulated operons containing CC2139 gene
| Regulog: | SahR - Caulobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Methionine metabolism |
| Effector: | S-adenosylhomocysteine |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Caulobacter crescentus CB15 | ||||
|
Position: -24
Score: 6.93642 Sequence: ACATAAAGATATCTTTATGT
Locus tag: CC2141
Name: sahR Funciton: Transcriptional regulator of methionine metabolism, ArsR family
Locus tag: CC2140
Name: metF Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
Locus tag: CC2139
Name: null Funciton: metallo-beta-lactamase superfamily protein
Locus tag: CC2138
Name: metH2 Funciton: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
Locus tag: CC2137
Name: metH Funciton: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13) |
||||
| sahR-metF-CC2139-metH2-metH | -24 | 6.9 | ACATAAAGATATCTTTATGT | CC2141 |
| Caulobacter segnis ATCC 21756 | ||||
|
Position: -1000
Score: 6.93642 Sequence: ACATAAAGATATCTTTATGT
Locus tag: Cseg_1280
Name: metF Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
Locus tag: Cseg_1281
Name: null Funciton: metallo-beta-lactamase superfamily protein
Locus tag: Cseg_1282
Name: metH2 Funciton: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
Locus tag: Cseg_1283
Name: metH Funciton: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13) |
||||
| metF-Cseg_1281-metH2-metH | -1000 | 6.9 | ACATAAAGATATCTTTATGT | Cseg_1280 |
| Caulobacter sp. K31 | ||||
|
Position: -24
Score: 6.93642 Sequence: ACATAAAGATATCTTTATGT
Locus tag: Caul_3410
Name: sahR Funciton: Transcriptional regulator of methionine metabolism, ArsR family
Locus tag: Caul_3409
Name: metF Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
Locus tag: Caul_3408
Name: null Funciton: metallo-beta-lactamase superfamily protein
Locus tag: Caul_3407
Name: metH2 Funciton: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
Locus tag: Caul_3406
Name: Caul_3406 Funciton: PIN domain protein
Locus tag: Caul_3405
Name: Caul_3405 Funciton: PIN domain protein
Locus tag: Caul_3404
Name: ddl Funciton: D-alanine--D-alanine ligase B (EC 6.3.2.4)
Locus tag: Caul_3403
Name: null Funciton: hypothetical protein
Locus tag: Caul_3402
Name: metH Funciton: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13) |
||||
| sahR-metF-Caul_3408-metH2-Caul_3406-Caul_3405-ddl-Caul_3403-metH | -24 | 6.9 | ACATAAAGATATCTTTATGT | Caul_3410 |