Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing ddl gene

Properties
Regulog: SahR - Caulobacterales
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Methionine metabolism
Effector: S-adenosylhomocysteine
Phylum: Proteobacteria/alpha
Built upon 14 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Caulobacter sp. K31
Position: -24
Score: 6.93642
Sequence: ACATAAAGATATCTTTATGT
Locus tag: Caul_3410
Name: sahR
Funciton: Transcriptional regulator of methionine metabolism, ArsR family
Locus tag: Caul_3409
Name: metF
Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
Locus tag: Caul_3408
Name: null
Funciton: metallo-beta-lactamase superfamily protein
Locus tag: Caul_3407
Name: metH2
Funciton: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
Locus tag: Caul_3406
Name: Caul_3406
Funciton: PIN domain protein
Locus tag: Caul_3405
Name: Caul_3405
Funciton: PIN domain protein
Locus tag: Caul_3404
Name: ddl
Funciton: D-alanine--D-alanine ligase B (EC 6.3.2.4)
Locus tag: Caul_3403
Name: null
Funciton: hypothetical protein
Locus tag: Caul_3402
Name: metH
Funciton: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
sahR-metF-Caul_3408-metH2-Caul_3406-Caul_3405-ddl-Caul_3403-metH -24 6.9 ACATAAAGATATCTTTATGT Caul_3410