Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing AZL_009210 gene

Properties
Regulog: SahR - Rhodospirillales
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Methionine metabolism
Effector: S-adenosylhomocysteine
Phylum: Proteobacteria/alpha
Built upon 17 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Azospirillum sp. B510
Position: -60
Score: 6.75299
Sequence: GCATAAAGATATCTTTATAT
Locus tag: AZL_009180
Name: sahR
Funciton: Transcriptional regulator of methionine metabolism, ArsR family
Locus tag: AZL_009190
Name: metF
Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
Locus tag: AZL_009200
Name: null
Funciton: hypothetical protein
Locus tag: AZL_009210
Name: null
Funciton: hypothetical protein
Locus tag: AZL_009220
Name: metH
Funciton: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
sahR-metF-AZL_009200-AZL_009210-metH -60 6.8 GCATAAAGATATCTTTATAT AZL_009180
© 2009-2020 RegPrecise