Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing metH2 gene

Properties
Regulog: SahR - Rhizobiales
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Methionine metabolism
Effector: S-adenosylhomocysteine
Phylum: Proteobacteria/alpha
Built upon 36 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Mesorhizobium loti MAFF303099
Position: -37
Score: 6.25946
Sequence: ATATAAAGAACTCTTTATAT
Locus tag: mlr1243
Name: metH2
Funciton: 5-methyltetrahydrofolate S-homocysteine methyltransferase
metH2 -37 6.3 ATATAAAGAACTCTTTATAT mlr1243
© 2009-2020 RegPrecise