Orthologous regulated operons containing metH2 gene
| Regulog: | SahR - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Methionine metabolism |
| Effector: | S-adenosylhomocysteine |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Mesorhizobium loti MAFF303099 | ||||
|
Position: -37
Score: 6.25946 Sequence: ATATAAAGAACTCTTTATAT
Locus tag: mlr1243
Name: metH2 Funciton: 5-methyltetrahydrofolate S-homocysteine methyltransferase |
||||
| metH2 | -37 | 6.3 | ATATAAAGAACTCTTTATAT | mlr1243 |