Orthologous regulated operons containing metK gene
| Regulog: | SahR - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Methionine metabolism |
| Effector: | S-adenosylhomocysteine |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | ||||
|
Position: -91
Score: 6.43662 Sequence: ACATAAAGATATATTTATGT
Locus tag: Atu0362
Name: metK Funciton: S-adenosylmethionine synthetase (EC 2.5.1.6) |
||||
| metK | -91 | 6.4 | ACATAAAGATATATTTATGT | Atu0362 |
| Rhizobium etli CFN 42 | ||||
|
Position: -94
Score: 6.56162 Sequence: ATATAAAGATATATTTATGT
Locus tag: RHE_CH00370
Name: metK Funciton: S-adenosylmethionine synthetase (EC 2.5.1.6) |
||||
| metK | -94 | 6.6 | ATATAAAGATATATTTATGT | RHE_CH00370 |
| Rhizobium leguminosarum bv. viciae 3841 | ||||
|
Position: -94
Score: 6.56162 Sequence: ATATAAAGATATATTTATGT
Locus tag: RL0389
Name: metK Funciton: S-adenosylmethionine synthetase (EC 2.5.1.6) |
||||
| metK | -94 | 6.6 | ATATAAAGATATATTTATGT | RL0389 |
| Rhizobium sp. NGR234 | ||||
|
Position: -93
Score: 6.56162 Sequence: ATATAAAGATATATTTATGT
Locus tag: NGR_c00480
Name: metK Funciton: S-adenosylmethionine synthetase (EC 2.5.1.6) |
||||
| metK | -93 | 6.6 | ATATAAAGATATATTTATGT | NGR_c00480 |
| Sinorhizobium meliloti 1021 | ||||
|
Position: -94
Score: 6.56162 Sequence: ATATAAAGATATATTTATGT
Locus tag: SMc01109
Name: metK Funciton: S-adenosylmethionine synthetase (EC 2.5.1.6) |
||||
| metK | -94 | 6.6 | ATATAAAGATATATTTATGT | SMc01109 |