Orthologous regulated operons containing lacA gene
Regulog: | LacI - Enterobacteriales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Lactose utilization |
Effector: | Allolactose |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||||
Position: -38
Score: 7.41669 Sequence: AATTGTGAGCGGATAACAATT
Locus tag: b0344
Name: lacZ Funciton: Beta-galactosidase (EC 3.2.1.23)
Locus tag: b0343
Name: lacY Funciton: Lactose permease, MFS family
Locus tag: b0342
Name: lacA Funciton: Galactoside O-acetyltransferase (EC 2.3.1.18) |
||||
lacZ-lacY-lacA | -38 | 7.4 | AATTGTGAGCGGATAACAATT | b0344 |