Orthologous regulated operons containing metK gene
Regulog: | SahR - Pseudomonadaceae |
Regulator type: | Transcription factor |
Regulator family: | ArsR |
Regulation mode: | repressor |
Biological process: | Methionine metabolism |
Effector: | S-adenosylhomocysteine |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Azotobacter vinelandii AvOP | ||||
Position: -62
Score: 6.86165 Sequence: ATATCAAAACTTTTTGATAC
Locus tag: Avin_05540
Name: sahR Funciton: Transcriptional regulator of methionine metabolism, ArsR family
Locus tag: Avin_05530
Name: metK Funciton: S-adenosylmethionine synthetase (EC 2.5.1.6) |
||||
sahR-metK | -62 | 6.9 | ATATCAAAACTTTTTGATAC | Avin_05540 |
Pseudomonas aeruginosa PAO1 | ||||
Position: -62
Score: 6.94857 Sequence: ATATCAAAAATTTTTGATAC
Locus tag: PA0547
Name: sahR Funciton: Transcriptional regulator of methionine metabolism, ArsR family
Locus tag: PA0546
Name: metK Funciton: S-adenosylmethionine synthetase (EC 2.5.1.6) |
||||
sahR-metK | -62 | 6.9 | ATATCAAAAATTTTTGATAC | PA0547 |
Pseudomonas entomophila L48 | ||||
Position: -62
Score: 7.16024 Sequence: ATATCAAAACTTTTTGATAT
Locus tag: PSEEN5025
Name: sahR Funciton: Transcriptional regulator of methionine metabolism, ArsR family
Locus tag: PSEEN5026
Name: metK Funciton: S-adenosylmethionine synthetase (EC 2.5.1.6) |
||||
sahR-metK | -62 | 7.2 | ATATCAAAACTTTTTGATAT | PSEEN5025 |
Pseudomonas fluorescens Pf-5 | ||||
Position: -35
Score: 7.16024 Sequence: ATATCAAAACTTTTTGATAT
Locus tag: PFL_5787
Name: sahR Funciton: Transcriptional regulator of methionine metabolism, ArsR family
Locus tag: PFL_5788
Name: metK Funciton: S-adenosylmethionine synthetase (EC 2.5.1.6) |
||||
sahR-metK | -35 | 7.2 | ATATCAAAACTTTTTGATAT | PFL_5787 |
Pseudomonas mendocina ymp | ||||
Position: -62
Score: 7.16024 Sequence: ATATCAAAACTTTTTGATAT
Locus tag: Pmen_0455
Name: sahR Funciton: Transcriptional regulator of methionine metabolism, ArsR family
Locus tag: Pmen_0454
Name: metK Funciton: S-adenosylmethionine synthetase (EC 2.5.1.6) |
||||
sahR-metK | -62 | 7.2 | ATATCAAAACTTTTTGATAT | Pmen_0455 |
Pseudomonas putida KT2440 | ||||
Position: -62
Score: 7.16024 Sequence: ATATCAAAACTTTTTGATAT
Locus tag: PP4966
Name: sahR Funciton: Transcriptional regulator of methionine metabolism, ArsR family
Locus tag: PP4967
Name: metK Funciton: S-adenosylmethionine synthetase (EC 2.5.1.6) |
||||
sahR-metK | -62 | 7.2 | ATATCAAAACTTTTTGATAT | PP4966 |
Pseudomonas stutzeri A1501 | ||||
Position: -63
Score: 7.16024 Sequence: ATATCAAAACTTTTTGATAT
Locus tag: PST_3925
Name: sahR Funciton: Transcriptional regulator of methionine metabolism, ArsR family
Locus tag: PST_3926
Name: metK Funciton: S-adenosylmethionine synthetase (EC 2.5.1.6) |
||||
sahR-metK | -63 | 7.2 | ATATCAAAACTTTTTGATAT | PST_3925 |
Pseudomonas syringae pv. tomato str. DC3000 | ||||
Position: -62
Score: 7.16024 Sequence: ATATCAAAACTTTTTGATAT
Locus tag: PSPTO0384
Name: sahR Funciton: Transcriptional regulator of methionine metabolism, ArsR family
Locus tag: PSPTO0383
Name: metK Funciton: S-adenosylmethionine synthetase (EC 2.5.1.6) |
||||
sahR-metK | -62 | 7.2 | ATATCAAAACTTTTTGATAT | PSPTO0384 |