Orthologous regulated operons containing agaL gene
| Regulog: | MsmR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Alpha-galactosides utilization |
| Effector: | Alpha-galactosides |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bacillus halodurans C-125 | ||||
|
Position: -97
Score: 5.84411 Sequence: TATTGAAAACGCTTACCCTA
Locus tag: BH2227
Name: msmR Funciton: Transcriptional regulator of alpha-galactoside utilization, LacI family
Locus tag: BH2226
Name: msmE Funciton: Multiple sugar ABC transporter, stachyose-binding protein
Locus tag: BH2225
Name: msmF Funciton: Multiple sugar ABC transporter, membrane-spanning permease protein MsmF
Locus tag: BH2224
Name: msmG Funciton: Multiple sugar ABC transporter, membrane-spanning permease protein MsmG
Locus tag: BH2223
Name: agaL Funciton: Alpha-galactosidase (EC 3.2.1.22) |
||||
| msmR-msmE-msmF-msmG-agaL | -97 | 5.8 | TATTGAAAACGCTTACCCTA | BH2227 |