Orthologous regulated operons containing msmR gene
| Regulog: | MsmR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Alpha-galactosides utilization |
| Effector: | Alpha-galactosides |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bacillus amyloliquefaciens FZB42 | ||||
|
Position: -93
Score: 5.40966 Sequence: TGTTGAAAACGCTTACTCTC
Locus tag: RBAM_027180
Name: msmR Funciton: Transcriptional regulator of alpha-galactoside utilization, LacI family
Locus tag: RBAM_027190
Name: msmE Funciton: Multiple sugar ABC transporter, stachyose-binding protein
Locus tag: RBAM_027200
Name: msmF Funciton: Multiple sugar ABC transporter, membrane-spanning permease protein MsmF
Locus tag: RBAM_027210
Name: msmG Funciton: Multiple sugar ABC transporter, membrane-spanning permease protein MsmG
Locus tag: RBAM_027220
Name: melA Funciton: Alpha-galactosidase (EC 3.2.1.22) |
||||
| msmR-msmE-msmF-msmG-melA | -93 | 5.4 | TGTTGAAAACGCTTACTCTC | RBAM_027180 |
| Bacillus halodurans C-125 | ||||
|
Position: -97
Score: 5.84411 Sequence: TATTGAAAACGCTTACCCTA
Locus tag: BH2227
Name: msmR Funciton: Transcriptional regulator of alpha-galactoside utilization, LacI family
Locus tag: BH2226
Name: msmE Funciton: Multiple sugar ABC transporter, stachyose-binding protein
Locus tag: BH2225
Name: msmF Funciton: Multiple sugar ABC transporter, membrane-spanning permease protein MsmF
Locus tag: BH2224
Name: msmG Funciton: Multiple sugar ABC transporter, membrane-spanning permease protein MsmG
Locus tag: BH2223
Name: agaL Funciton: Alpha-galactosidase (EC 3.2.1.22) |
||||
| msmR-msmE-msmF-msmG-agaL | -97 | 5.8 | TATTGAAAACGCTTACCCTA | BH2227 |
| Bacillus licheniformis DSM 13 | ||||
|
Position: -77
Score: 4.63121 Sequence: TATTGAAAACTTTTACCTTG
Locus tag: BLi01139
Name: msmR Funciton: Transcriptional regulator of alpha-galactoside utilization, LacI family |
||||
| msmR | -77 | 4.6 | TATTGAAAACTTTTACCTTG | BLi01139 |
| Bacillus pumilus SAFR-032 | ||||
|
Position: -80
Score: 4.39462 Sequence: ACTTGAAAGCGCTTTACCAA
Locus tag: BPUM_1754
Name: msmR Funciton: Transcriptional regulator of alpha-galactoside utilization, LacI family
Locus tag: BPUM_1753
Name: msmE Funciton: Multiple sugar ABC transporter, stachyose-binding protein
Locus tag: BPUM_1752
Name: msmF Funciton: Multiple sugar ABC transporter, membrane-spanning permease protein MsmF
Locus tag: BPUM_1751
Name: msmG Funciton: Multiple sugar ABC transporter, membrane-spanning permease protein MsmG
Locus tag: BPUM_1750
Name: melA Funciton: Alpha-galactosidase (EC 3.2.1.22) |
||||
| msmR-msmE-msmF-msmG-melA | -80 | 4.4 | ACTTGAAAGCGCTTTACCAA | BPUM_1754 |
| Bacillus subtilis subsp. subtilis str. 168 | ||||
|
Position: -88
Score: 5.53766 Sequence: TATTGTAACCGCTTACTTTT
Locus tag: BSU30260
Name: msmR Funciton: Transcriptional regulator of alpha-galactoside utilization, LacI family
Locus tag: BSU30270
Name: msmE Funciton: Multiple sugar ABC transporter, stachyose-binding protein
Locus tag: BSU30280
Name: msmF Funciton: Multiple sugar ABC transporter, membrane-spanning permease protein MsmF
Locus tag: BSU30290
Name: msmG Funciton: Multiple sugar ABC transporter, membrane-spanning permease protein MsmG
Locus tag: BSU30300
Name: melA Funciton: Alpha-galactosidase (EC 3.2.1.22) |
||||
| msmR-msmE-msmF-msmG-melA | -88 | 5.5 | TATTGTAACCGCTTACTTTT | BSU30260 |