Orthologous regulated operons containing yuiF gene
| Regulog: | HisR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | TrpR |
| Regulation mode: | repressor |
| Biological process: | Histidine biosynthesis |
| Effector: | Histidine |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Anoxybacillus flavithermus WK1 | ||||
|
Position: -34
Score: 5.24991 Sequence: CAATTTATCAAACTAAAGTG
Locus tag: Aflv_1385
Name: yuiF Funciton: Histidine permease |
||||
| yuiF | -34 | 5.2 | CAATTTATCAAACTAAAGTG | Aflv_1385 |
| Bacillus amyloliquefaciens FZB42 | ||||
|
Position: -39
Score: 5.7462 Sequence: TACATTAGCAAACTAAAGGA
Locus tag: RBAM_029090
Name: yuiF Funciton: Histidine permease |
||||
| yuiF | -39 | 5.7 | TACATTAGCAAACTAAAGGA | RBAM_029090 |
| Bacillus clausii KSM-K16 | ||||
|
Position: -30
Score: 4.83117 Sequence: TGATTTAATAAGATAAAGGA
Locus tag: ABC2918
Name: yuiF Funciton: Histidine permease |
||||
| yuiF | -30 | 4.8 | TGATTTAATAAGATAAAGGA | ABC2918 |
| Bacillus halodurans C-125 | ||||
|
Position: -47
Score: 5.09523 Sequence: TGATTTAATAAACTAAAGCA
Locus tag: BH3359
Name: yuiF Funciton: Histidine permease |
||||
| yuiF | -47 | 5.1 | TGATTTAATAAACTAAAGCA | BH3359 |
| Bacillus licheniformis DSM 13 | ||||
|
Position: -40
Score: 5.78531 Sequence: TACATTAGCAAACTAAAGTG
Locus tag: BLi03386
Name: yuiF Funciton: Histidine permease |
||||
| yuiF | -40 | 5.8 | TACATTAGCAAACTAAAGTG | BLi03386 |
| Bacillus pumilus SAFR-032 | ||||
|
Position: -36
Score: 5.78059 Sequence: TACATTAGTAAACTAAAGGA
Locus tag: BPUM_2865
Name: yuiF Funciton: Histidine permease |
||||
| yuiF | -36 | 5.8 | TACATTAGTAAACTAAAGGA | BPUM_2865 |
| Bacillus subtilis subsp. subtilis str. 168 | ||||
|
Position: -39
Score: 5.7462 Sequence: TACATTAGCAAACTAAAGGA
Locus tag: BSU32040
Name: yuiF Funciton: Histidine permease |
||||
| yuiF | -39 | 5.7 | TACATTAGCAAACTAAAGGA | BSU32040 |
| Oceanobacillus iheyensis HTE831 | ||||
|
Position: -50
Score: 4.79583 Sequence: TGCTTTATCATGATGAAGTA
Locus tag: OB0879
Name: yuiF Funciton: Histidine permease |
||||
| yuiF | -50 | 4.8 | TGCTTTATCATGATGAAGTA | OB0879 |