Orthologous regulated operons containing PF09313 gene
| Regulog: | NsrR - Caulobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | repressor |
| Biological process: | Nitrosative stress response |
| Effector: | Nitric oxide |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Caulobacter sp. K31 | ||||
|
Position: -34
Score: 4.89943 Sequence: AGATGCATTTGATAAGCATCA
Locus tag: Caul_0855
Name: PF09313 Funciton: Truncated hemoglobins
Locus tag: Caul_0856
Name: hmp Funciton: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17) |
||||
| PF09313-hmp | -34 | 4.9 | AGATGCATTTGATAAGCATCA | Caul_0855 |