Orthologous regulated operons containing fadL2 gene
| Regulog: | PsrA - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Photobacterium profundum SS9 | ||||
|
Position: -373
Score: 5.05201 Sequence: TTCTAAACGCCCGTTTTATT
Position: -355
Score: 5.52344 Sequence: TTTAAAACGGTTGTTTTAAA
Locus tag: PBPRA2573
Name: fadL2 Funciton: Long-chain fatty acid transport protein |
||||
| fadL2 | -373 | 5.1 | TTCTAAACGCCCGTTTTATT | PBPRA2573 |
| -355 | 5.5 | TTTAAAACGGTTGTTTTAAA | ||