Orthologous regulated operons containing nadC gene
| Regulog: | Rex - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | Rex |
| Regulation mode: | repressor |
| Biological process: | Energy metabolism |
| Effector: | NADH |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Paenibacillus sp. JDR-2 | ||||
|
Position: -84
Score: 5.97136 Sequence: TTTGTGCATCAATTCACAAA
Locus tag: Pjdr2_0068
Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-)
Locus tag: Pjdr2_0069
Name: nadB Funciton: L-aspartate oxidase (EC 1.4.3.16)
Locus tag: Pjdr2_0070
Name: nadC Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
||||
| nadA-nadB-nadC | -84 | 6 | TTTGTGCATCAATTCACAAA | Pjdr2_0068 |