Orthologous regulated operons containing Haur_1311 gene
| Regulog: | Zur - Chloroflexia |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Chloroflexi |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Herpetosiphon aurantiacus ATCC 23779 | ||||
|
Position: -47
Score: 5.94691 Sequence: TATTGATATAATATATCAGTA
Locus tag: Haur_1311
Name: null Funciton: Acetyltransferase |
||||
| Haur_1311 | -47 | 5.9 | TATTGATATAATATATCAGTA | Haur_1311 |