Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Haur_1311 gene

Properties
Regulog: Zur - Chloroflexia
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Chloroflexi
Built upon 19 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Herpetosiphon aurantiacus ATCC 23779
Position: -47
Score: 5.94691
Sequence: TATTGATATAATATATCAGTA
Locus tag: Haur_1311
Name: null
Funciton: Acetyltransferase
Haur_1311 -47 5.9 TATTGATATAATATATCAGTA Haur_1311
© 2009-2020 RegPrecise