Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Haur_3793 gene

Properties
Regulog: Zur - Chloroflexia
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Chloroflexi
Built upon 19 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Herpetosiphon aurantiacus ATCC 23779
Position: -34
Score: 6.13962
Sequence: TATTGATATCAAGTATCAATA
Locus tag: Haur_3793
Name: null
Funciton: Thioredoxin reductase (EC 1.8.1.9)
Haur_3793 -34 6.1 TATTGATATCAAGTATCAATA Haur_3793
© 2009-2020 RegPrecise