Orthologous regulated operons containing yciC3 gene
| Regulog: | Zur - Chloroflexia |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Chloroflexi |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Herpetosiphon aurantiacus ATCC 23779 | ||||
|
Position: -54
Score: 6.59304 Sequence: TATTGATATATTGTATCAATA
Locus tag: Haur_2062
Name: yciC3 Funciton: Putative metal chaperone involved in Zn homeostasis, COG0523 family |
||||
| yciC3 | -54 | 6.6 | TATTGATATATTGTATCAATA | Haur_2062 |