Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Haur_0321 gene

Properties
Regulog: FetR - Chloroflexia
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Chloroflexi
Built upon 13 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Chloroflexus sp. Y-400-fl
Position: -136
Score: 5.79717
Sequence: TAATTAGCATACACTAACTA
Locus tag: Chy400_4135
Name: Haur_0321
Funciton: hypothetical transporter, MFS superfamily
Locus tag: Chy400_4136
Name: fepB
Funciton: Iron siderophore ABC transporter, periplasmic component
Haur_0321-fepB -136 5.8 TAATTAGCATACACTAACTA Chy400_4135
© 2009-2020 RegPrecise