Orthologous regulated operons containing fepB2 gene
Regulog: | FetR - Chloroflexia |
Regulator type: | Transcription factor |
Regulator family: | DtxR |
Regulation mode: | repressor |
Biological process: | Iron homeostasis |
Effector: | Iron ion, (Fe2+) |
Phylum: | Chloroflexi |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Chloroflexus sp. Y-400-fl | ||||
Position: -158
Score: 6.18424 Sequence: TTATTAGCATATACTAACCT
Locus tag: Chy400_0344
Name: COG0716 Funciton: flavodoxin
Locus tag: Chy400_0343
Name: null Funciton: hypothetical protein
Locus tag: Chy400_0342
Name: fepB2 Funciton: Iron siderophore ABC transporter, periplasmic component
Locus tag: Chy400_0341
Name: null Funciton: hypothetical protein |
||||
COG0716-Chy400_0343-fepB2-Chy400_0341 | -158 | 6.2 | TTATTAGCATATACTAACCT | Chy400_0344 |