Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Chy400_0343 gene

Properties
Regulog: FetR - Chloroflexia
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Chloroflexi
Built upon 13 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Chloroflexus sp. Y-400-fl
Position: -158
Score: 6.18424
Sequence: TTATTAGCATATACTAACCT
Locus tag: Chy400_0344
Name: COG0716
Funciton: flavodoxin
Locus tag: Chy400_0343
Name: null
Funciton: hypothetical protein
Locus tag: Chy400_0342
Name: fepB2
Funciton: Iron siderophore ABC transporter, periplasmic component
Locus tag: Chy400_0341
Name: null
Funciton: hypothetical protein
COG0716-Chy400_0343-fepB2-Chy400_0341 -158 6.2 TTATTAGCATATACTAACCT Chy400_0344
© 2009-2020 RegPrecise