Orthologous regulated operons containing RoseRS_3573 gene
| Regulog: | FetR - Chloroflexia |
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Chloroflexi |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Roseiflexus castenholzii DSM 13941 | ||||
|
Position: -123
Score: 5.90096 Sequence: TTATTAGACTATACTAACTT
Locus tag: Rcas_4373
Name: hmuV Funciton: Heme ABC transporter, ATPase component HmuV
Locus tag: Rcas_4372
Name: hmuT Funciton: Heme ABC transporter, hemin-binding periplasmic component hmuT
Locus tag: Rcas_4371
Name: hmuU Funciton: Heme ABC transporter, permease component HmuU
Locus tag: Rcas_4370
Name: RoseRS_3567 Funciton: hypothetical protein
Locus tag: Rcas_4369
Name: RoseRS_0755 Funciton: Hypothetical similar to CcmC, putative heme lyase for CcmE
Locus tag: Rcas_4368
Name: RoseRS_3569 Funciton: hypothetical protein
Locus tag: Rcas_4367
Name: COG2329 Funciton: hypothetical monooxygenase
Locus tag: Rcas_4366
Name: RoseRS_3571 Funciton: Hemin ABC transporter, permease protein
Locus tag: Rcas_4365
Name: RoseRS_3572 Funciton: hypothetical protein
Locus tag: Rcas_4364
Name: RoseRS_3573 Funciton: hypothetical protein
Locus tag: Rcas_4363
Name: fetR Funciton: Ferrous iron dependent repressor, DtxR family |
||||
| hmuV-hmuT-hmuU-RoseRS_3567-RoseRS_0755-RoseRS_3569-COG2329-RoseRS_3571-RoseRS_3572-RoseRS_3573-fetR | -123 | 5.9 | TTATTAGACTATACTAACTT | Rcas_4373 |
| Roseiflexus sp. RS-1 | ||||
|
Position: -109
Score: 5.96912 Sequence: TTATTAGACTATACTAACCA
Locus tag: RoseRS_3564
Name: hmuV Funciton: Heme ABC transporter, ATPase component HmuV
Locus tag: RoseRS_3565
Name: hmuT Funciton: Heme ABC transporter, hemin-binding periplasmic component hmuT
Locus tag: RoseRS_3566
Name: hmuU Funciton: Heme ABC transporter, permease component HmuU
Locus tag: RoseRS_3567
Name: RoseRS_3567 Funciton: hypothetical protein
Locus tag: RoseRS_3568
Name: RoseRS_0755 Funciton: Hypothetical similar to CcmC, putative heme lyase for CcmE
Locus tag: RoseRS_3569
Name: RoseRS_3569 Funciton: hypothetical protein
Locus tag: RoseRS_3570
Name: COG2329 Funciton: hypothetical monooxygenase
Locus tag: RoseRS_3571
Name: RoseRS_3571 Funciton: Hemin ABC transporter, permease protein
Locus tag: RoseRS_3572
Name: RoseRS_3572 Funciton: hypothetical protein
Locus tag: RoseRS_3573
Name: RoseRS_3573 Funciton: hypothetical protein
Locus tag: RoseRS_3574
Name: fetR Funciton: Ferrous iron dependent repressor, DtxR family |
||||
| hmuV-hmuT-hmuU-RoseRS_3567-RoseRS_0755-RoseRS_3569-COG2329-RoseRS_3571-RoseRS_3572-RoseRS_3573-fetR | -109 | 6 | TTATTAGACTATACTAACCA | RoseRS_3564 |