Orthologous regulated operons containing RoseRS_3571 gene

Properties
Regulog:	FetR - Chloroflexia
Regulator type:	Transcription factor
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Chloroflexi

Built upon 13 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Roseiflexus castenholzii DSM 13941
Position: -123 Score: 5.90096 Sequence: TTATTAGACTATACTAACTT Locus tag: Rcas_4373 Name: hmuV Funciton: Heme ABC transporter, ATPase component HmuV Locus tag: Rcas_4372 Name: hmuT Funciton: Heme ABC transporter, hemin-binding periplasmic component hmuT Locus tag: Rcas_4371 Name: hmuU Funciton: Heme ABC transporter, permease component HmuU Locus tag: Rcas_4370 Name: RoseRS_3567 Funciton: hypothetical protein Locus tag: Rcas_4369 Name: RoseRS_0755 Funciton: Hypothetical similar to CcmC, putative heme lyase for CcmE Locus tag: Rcas_4368 Name: RoseRS_3569 Funciton: hypothetical protein Locus tag: Rcas_4367 Name: COG2329 Funciton: hypothetical monooxygenase Locus tag: Rcas_4366 Name: RoseRS_3571 Funciton: Hemin ABC transporter, permease protein Locus tag: Rcas_4365 Name: RoseRS_3572 Funciton: hypothetical protein Locus tag: Rcas_4364 Name: RoseRS_3573 Funciton: hypothetical protein Locus tag: Rcas_4363 Name: fetR Funciton: Ferrous iron dependent repressor, DtxR family
hmuV-hmuT-hmuU-RoseRS_3567-RoseRS_0755-RoseRS_3569-COG2329-RoseRS_3571-RoseRS_3572-RoseRS_3573-fetR	-123	5.9	TTATTAGACTATACTAACTT	Rcas_4373
Roseiflexus sp. RS-1
Position: -109 Score: 5.96912 Sequence: TTATTAGACTATACTAACCA Locus tag: RoseRS_3564 Name: hmuV Funciton: Heme ABC transporter, ATPase component HmuV Locus tag: RoseRS_3565 Name: hmuT Funciton: Heme ABC transporter, hemin-binding periplasmic component hmuT Locus tag: RoseRS_3566 Name: hmuU Funciton: Heme ABC transporter, permease component HmuU Locus tag: RoseRS_3567 Name: RoseRS_3567 Funciton: hypothetical protein Locus tag: RoseRS_3568 Name: RoseRS_0755 Funciton: Hypothetical similar to CcmC, putative heme lyase for CcmE Locus tag: RoseRS_3569 Name: RoseRS_3569 Funciton: hypothetical protein Locus tag: RoseRS_3570 Name: COG2329 Funciton: hypothetical monooxygenase Locus tag: RoseRS_3571 Name: RoseRS_3571 Funciton: Hemin ABC transporter, permease protein Locus tag: RoseRS_3572 Name: RoseRS_3572 Funciton: hypothetical protein Locus tag: RoseRS_3573 Name: RoseRS_3573 Funciton: hypothetical protein Locus tag: RoseRS_3574 Name: fetR Funciton: Ferrous iron dependent repressor, DtxR family
hmuV-hmuT-hmuU-RoseRS_3567-RoseRS_0755-RoseRS_3569-COG2329-RoseRS_3571-RoseRS_3572-RoseRS_3573-fetR	-109	6	TTATTAGACTATACTAACCA	RoseRS_3564