Orthologous regulated operons containing mntD gene

Properties
Regulog:	MntR - Chloroflexia
Regulator type:	Transcription factor
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Phylum:	Chloroflexi

Built upon 9 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Chloroflexus aggregans DSM 9485
Position: -38 Score: 6.03137 Sequence: ATTTTAGGTTAGGCTAAAAT Locus tag: Cagg_3553 Name: mntA Funciton: Manganese ABC transporter, periplasmic-binding protein Locus tag: Cagg_3554 Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: Cagg_3555 Name: mntC Funciton: Manganese ABC transporter, inner membrane permease protein Locus tag: Cagg_3556 Name: mntD Funciton: Manganese ABC transporter, inner membrane permease protein
mntA-mntB-mntC-mntD	-38	6	ATTTTAGGTTAGGCTAAAAT	Cagg_3553
Chloroflexus sp. Y-400-fl
Position: -40 Score: 5.82405 Sequence: GATTTAGGTAAGGCTAAAAT Locus tag: Chy400_0210 Name: mntA Funciton: Manganese ABC transporter, periplasmic-binding protein Locus tag: Chy400_0209 Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: Chy400_0208 Name: mntC Funciton: Manganese ABC transporter, inner membrane permease protein Locus tag: Chy400_0207 Name: mntD Funciton: Manganese ABC transporter, inner membrane permease protein
mntA-mntB-mntC-mntD	-40	5.8	GATTTAGGTAAGGCTAAAAT	Chy400_0210
Herpetosiphon aurantiacus ATCC 23779
Position: -51 Score: 5.75184 Sequence: CTTTTAGGTATGCCTAAATA Locus tag: Haur_4030 Name: mntA Funciton: Manganese ABC transporter, periplasmic-binding protein Locus tag: Haur_4029 Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: Haur_4028 Name: mntC Funciton: Manganese ABC transporter, inner membrane permease protein Locus tag: Haur_4027 Name: mntD Funciton: Manganese ABC transporter, inner membrane permease protein
mntA-mntB-mntC-mntD	-51	5.8	CTTTTAGGTATGCCTAAATA	Haur_4030
Roseiflexus castenholzii DSM 13941
Position: -55 Score: 5.90607 Sequence: ATTTTAGGATTTCCAAAATT Locus tag: Rcas_1724 Name: mntA Funciton: Manganese ABC transporter, periplasmic-binding protein Locus tag: Rcas_1723 Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: Rcas_1722 Name: mntC Funciton: Manganese ABC transporter, inner membrane permease protein Locus tag: Rcas_1721 Name: mntD Funciton: Manganese ABC transporter, inner membrane permease protein
mntA-mntB-mntC-mntD	-55	5.9	ATTTTAGGATTTCCAAAATT	Rcas_1724
Roseiflexus sp. RS-1
Position: -42 Score: 5.63839 Sequence: GATTTAGGCAAGACAAAATT Locus tag: RoseRS_3070 Name: mntA Funciton: Manganese ABC transporter, periplasmic-binding protein Locus tag: RoseRS_3069 Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: RoseRS_3068 Name: mntC Funciton: Manganese ABC transporter, inner membrane permease protein Locus tag: RoseRS_3067 Name: mntD Funciton: Manganese ABC transporter, inner membrane permease protein
mntA-mntB-mntC-mntD	-42	5.6	GATTTAGGCAAGACAAAATT	RoseRS_3070