Orthologous regulated operons containing mntC gene
| Regulog: | MntR - Chloroflexia |
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Chloroflexi |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Chloroflexus aggregans DSM 9485 | ||||
|
Position: -38
Score: 6.03137 Sequence: ATTTTAGGTTAGGCTAAAAT
Locus tag: Cagg_3553
Name: mntA Funciton: Manganese ABC transporter, periplasmic-binding protein
Locus tag: Cagg_3554
Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: Cagg_3555
Name: mntC Funciton: Manganese ABC transporter, inner membrane permease protein
Locus tag: Cagg_3556
Name: mntD Funciton: Manganese ABC transporter, inner membrane permease protein |
||||
| mntA-mntB-mntC-mntD | -38 | 6 | ATTTTAGGTTAGGCTAAAAT | Cagg_3553 |
| Chloroflexus sp. Y-400-fl | ||||
|
Position: -40
Score: 5.82405 Sequence: GATTTAGGTAAGGCTAAAAT
Locus tag: Chy400_0210
Name: mntA Funciton: Manganese ABC transporter, periplasmic-binding protein
Locus tag: Chy400_0209
Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: Chy400_0208
Name: mntC Funciton: Manganese ABC transporter, inner membrane permease protein
Locus tag: Chy400_0207
Name: mntD Funciton: Manganese ABC transporter, inner membrane permease protein |
||||
| mntA-mntB-mntC-mntD | -40 | 5.8 | GATTTAGGTAAGGCTAAAAT | Chy400_0210 |
| Herpetosiphon aurantiacus ATCC 23779 | ||||
|
Position: -51
Score: 5.75184 Sequence: CTTTTAGGTATGCCTAAATA
Locus tag: Haur_4030
Name: mntA Funciton: Manganese ABC transporter, periplasmic-binding protein
Locus tag: Haur_4029
Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: Haur_4028
Name: mntC Funciton: Manganese ABC transporter, inner membrane permease protein
Locus tag: Haur_4027
Name: mntD Funciton: Manganese ABC transporter, inner membrane permease protein |
||||
| mntA-mntB-mntC-mntD | -51 | 5.8 | CTTTTAGGTATGCCTAAATA | Haur_4030 |
| Roseiflexus castenholzii DSM 13941 | ||||
|
Position: -55
Score: 5.90607 Sequence: ATTTTAGGATTTCCAAAATT
Locus tag: Rcas_1724
Name: mntA Funciton: Manganese ABC transporter, periplasmic-binding protein
Locus tag: Rcas_1723
Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: Rcas_1722
Name: mntC Funciton: Manganese ABC transporter, inner membrane permease protein
Locus tag: Rcas_1721
Name: mntD Funciton: Manganese ABC transporter, inner membrane permease protein |
||||
| mntA-mntB-mntC-mntD | -55 | 5.9 | ATTTTAGGATTTCCAAAATT | Rcas_1724 |
| Roseiflexus sp. RS-1 | ||||
|
Position: -42
Score: 5.63839 Sequence: GATTTAGGCAAGACAAAATT
Locus tag: RoseRS_3070
Name: mntA Funciton: Manganese ABC transporter, periplasmic-binding protein
Locus tag: RoseRS_3069
Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: RoseRS_3068
Name: mntC Funciton: Manganese ABC transporter, inner membrane permease protein
Locus tag: RoseRS_3067
Name: mntD Funciton: Manganese ABC transporter, inner membrane permease protein |
||||
| mntA-mntB-mntC-mntD | -42 | 5.6 | GATTTAGGCAAGACAAAATT | RoseRS_3070 |