Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing mntB gene

Properties
Regulog: MntR - Chloroflexia
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Chloroflexi
Built upon 9 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Chloroflexus aggregans DSM 9485
Position: -38
Score: 6.03137
Sequence: ATTTTAGGTTAGGCTAAAAT
Locus tag: Cagg_3553
Name: mntA
Funciton: Manganese ABC transporter, periplasmic-binding protein
Locus tag: Cagg_3554
Name: mntB
Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: Cagg_3555
Name: mntC
Funciton: Manganese ABC transporter, inner membrane permease protein
Locus tag: Cagg_3556
Name: mntD
Funciton: Manganese ABC transporter, inner membrane permease protein
mntA-mntB-mntC-mntD -38 6 ATTTTAGGTTAGGCTAAAAT Cagg_3553
Chloroflexus sp. Y-400-fl
Position: -40
Score: 5.82405
Sequence: GATTTAGGTAAGGCTAAAAT
Locus tag: Chy400_0210
Name: mntA
Funciton: Manganese ABC transporter, periplasmic-binding protein
Locus tag: Chy400_0209
Name: mntB
Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: Chy400_0208
Name: mntC
Funciton: Manganese ABC transporter, inner membrane permease protein
Locus tag: Chy400_0207
Name: mntD
Funciton: Manganese ABC transporter, inner membrane permease protein
mntA-mntB-mntC-mntD -40 5.8 GATTTAGGTAAGGCTAAAAT Chy400_0210
Herpetosiphon aurantiacus ATCC 23779
Position: -51
Score: 5.75184
Sequence: CTTTTAGGTATGCCTAAATA
Locus tag: Haur_4030
Name: mntA
Funciton: Manganese ABC transporter, periplasmic-binding protein
Locus tag: Haur_4029
Name: mntB
Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: Haur_4028
Name: mntC
Funciton: Manganese ABC transporter, inner membrane permease protein
Locus tag: Haur_4027
Name: mntD
Funciton: Manganese ABC transporter, inner membrane permease protein
mntA-mntB-mntC-mntD -51 5.8 CTTTTAGGTATGCCTAAATA Haur_4030
Roseiflexus castenholzii DSM 13941
Position: -55
Score: 5.90607
Sequence: ATTTTAGGATTTCCAAAATT
Locus tag: Rcas_1724
Name: mntA
Funciton: Manganese ABC transporter, periplasmic-binding protein
Locus tag: Rcas_1723
Name: mntB
Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: Rcas_1722
Name: mntC
Funciton: Manganese ABC transporter, inner membrane permease protein
Locus tag: Rcas_1721
Name: mntD
Funciton: Manganese ABC transporter, inner membrane permease protein
mntA-mntB-mntC-mntD -55 5.9 ATTTTAGGATTTCCAAAATT Rcas_1724
Roseiflexus sp. RS-1
Position: -42
Score: 5.63839
Sequence: GATTTAGGCAAGACAAAATT
Locus tag: RoseRS_3070
Name: mntA
Funciton: Manganese ABC transporter, periplasmic-binding protein
Locus tag: RoseRS_3069
Name: mntB
Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: RoseRS_3068
Name: mntC
Funciton: Manganese ABC transporter, inner membrane permease protein
Locus tag: RoseRS_3067
Name: mntD
Funciton: Manganese ABC transporter, inner membrane permease protein
mntA-mntB-mntC-mntD -42 5.6 GATTTAGGCAAGACAAAATT RoseRS_3070