Orthologous regulated operons containing grpE gene

Properties
Regulog:	HrcA - Chloroflexia
Regulator type:	Transcription factor
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Phylum:	Chloroflexi

Built upon 16 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Chloroflexus aggregans DSM 9485
Position: -55 Score: 7.59523 Sequence: TTAGCACTCTCGCCTCACGAGTGCTAA Locus tag: Cagg_2696 Name: hrcA Funciton: Heat-inducible transcription repressor HrcA Locus tag: Cagg_2695 Name: grpE Funciton: Heat shock protein GrpE Locus tag: Cagg_2694 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: Cagg_2693 Name: dnaJ Funciton: Chaperone protein DnaJ
hrcA-grpE-dnaK-dnaJ	-55	7.6	TTAGCACTCTCGCCTCACGAGTGCTAA	Cagg_2696
Chloroflexus sp. Y-400-fl
Position: -55 Score: 7.43587 Sequence: TTAGCACTCTCACCTCACGAGTGCTAA Locus tag: Chy400_2238 Name: hrcA Funciton: Heat-inducible transcription repressor HrcA Locus tag: Chy400_2237 Name: grpE Funciton: Heat shock protein GrpE Locus tag: Chy400_2236 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: Chy400_2235 Name: dnaJ Funciton: Chaperone protein DnaJ
hrcA-grpE-dnaK-dnaJ	-55	7.4	TTAGCACTCTCACCTCACGAGTGCTAA	Chy400_2238
Herpetosiphon aurantiacus ATCC 23779
Position: -40 Score: 7.325 Sequence: TTAGCACTCCTCGGCCAAGAGTGCTAA Locus tag: Haur_0438 Name: hrcA Funciton: Heat-inducible transcription repressor HrcA Locus tag: Haur_0439 Name: grpE Funciton: Heat shock protein GrpE Locus tag: Haur_0440 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: Haur_0441 Name: dnaJ Funciton: Chaperone protein DnaJ
hrcA-grpE-dnaK-dnaJ	-40	7.3	TTAGCACTCCTCGGCCAAGAGTGCTAA	Haur_0438
Roseiflexus castenholzii DSM 13941
Position: -102 Score: 7.22691 Sequence: CTAGCACTCACCGGTCGAGAGTGCTAA Locus tag: Rcas_4390 Name: hrcA Funciton: Heat-inducible transcription repressor HrcA Locus tag: Rcas_4391 Name: grpE Funciton: Heat shock protein GrpE Locus tag: Rcas_4392 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: Rcas_4393 Name: dnaJ Funciton: Chaperone protein DnaJ
hrcA-grpE-dnaK-dnaJ	-102	7.2	CTAGCACTCACCGGTCGAGAGTGCTAA	Rcas_4390
Roseiflexus sp. RS-1
Position: -190 Score: 7.07536 Sequence: CTAGCACTCAATAGTCGAGAGTGCTAA Locus tag: RoseRS_3462 Name: hrcA Funciton: Heat-inducible transcription repressor HrcA Locus tag: RoseRS_3461 Name: grpE Funciton: Heat shock protein GrpE Locus tag: RoseRS_3460 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: RoseRS_3459 Name: dnaJ Funciton: Chaperone protein DnaJ
hrcA-grpE-dnaK-dnaJ	-190	7.1	CTAGCACTCAATAGTCGAGAGTGCTAA	RoseRS_3462