Orthologous regulated operons containing Desal_2342 gene
| Regulog: | Dbac_0104 - Desulfovibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | |
| Biological process: | Metabolite transport |
| Effector: | |
| Phylum: | Proteobacteria/delta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Desulfovibrio salexigens DSM 2638 | ||||
|
Position: -42
Score: 5.32107 Sequence: AAGTTAAAGTGAATTCACAT
Position: -36
Score: 5.54038 Sequence: AAGTGAATTCACATTCACAT
Locus tag: Desal_2340
Name: null Funciton: transcriptional regulator, TetR family
Locus tag: Desal_2341
Name: null Funciton: Predicted membrane fusion protein (MFP) component of efflux pump, membrane anchor protein YbhG
Locus tag: Desal_2342
Name: null Funciton: ABC transporter ATP-binding protein
Locus tag: Desal_2343
Name: null Funciton: ABC-type multidrug transport system, permease component |
||||
| Desal_2340-Desal_2341-Desal_2342-Desal_2343 | -42 | 5.3 | AAGTTAAAGTGAATTCACAT | Desal_2340 |
| -36 | 5.5 | AAGTGAATTCACATTCACAT | ||