Orthologous regulated operons containing Dbac_0104 gene
| Regulog: | Dbac_0104 - Desulfovibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | |
| Biological process: | Metabolite transport |
| Effector: | |
| Phylum: | Proteobacteria/delta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Desulfomicrobium baculatum DSM 4028 | ||||
|
Position: -28
Score: 5.87366 Sequence: AAGTGAACGATCGTTAACTA
Locus tag: Dbac_0104
Name: null Funciton: transcriptional regulator, TetR family |
||||
| Dbac_0104 | -28 | 5.9 | AAGTGAACGATCGTTAACTA | Dbac_0104 |