Orthologous regulated operons containing DVU2816 gene
Regulog: | Dbac_0104 - Desulfovibrionales |
Regulator type: | Transcription factor |
Regulator family: | TetR |
Regulation mode: | |
Biological process: | Metabolite transport |
Effector: | |
Phylum: | Proteobacteria/delta |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Desulfomicrobium baculatum DSM 4028 | ||||
Position: -54
Score: 6.09597 Sequence: AAGTGAACACTTGTTCACAT
Locus tag: Dbac_0103
Name: acrA Funciton: efflux transporter, RND family, MFP subunit
Locus tag: Dbac_0102
Name: null Funciton: RND efflux system, inner membrane transporter CmeB
Locus tag: Dbac_0101
Name: null Funciton: RND efflux system, outer membrane lipoprotein, NodT family |
||||
acrA-Dbac_0102-Dbac_0101 | -54 | 6.1 | AAGTGAACACTTGTTCACAT | Dbac_0103 |